www.nettime.org
Nettime mailing list archives

Hari Kunzru: Gene Genie
nettime on Sun, 20 Jun 1999 00:22:51 +0200 (CEST)


[Date Prev] [Date Next] [Thread Prev] [Thread Next] [Date Index] [Thread Index]

Hari Kunzru: Gene Genie


- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - 
<nettime-l-temp {AT} material.net> is the temporary home of the nettime-l list
while desk.nl rebuilds its list-serving machine.  please continue to send
messages to <nettime-l {AT} desk.nl> and your commands to <majordomo {AT} desk.nl>.
nettime-l-temp should be active for approximately 2 weeks (11-28 Jun 99).
- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - 


Date: Fri, 18 Jun 1999 18:07:34 +0100
To: nettime-l {AT} Desk.nl
From: Hari Kunzru <hari {AT} dircon.co.uk>
Subject: Gene Genie

      [slightly deHTMLified ( * = italic, _ = underscore ) 
       and slightly reformatted at nettime--tb]

[This article, based on a visit to the UK headquarters of the Human 
Genome Project, appears in the current issue of Tank magazine - Hari
Kunzru]



Gene Genie


The receptionist is
chatting to a friend on the phone. Should they meet for lunch? The
canteen has savoury pancakes, and they're always nice. Oh yes, she's
glad it's Friday too. On the counter in front of her is a book for
signing visitors in and out, a little stand-up calendar, and a
collecting box for a cancer charity. A couple walk past and one of them
drops in a coin. The pair are both young, early twenties, dressed in
casual slouching-around clothes. He has a pony tail and a teeshirt that
says 'dazed and confused' in a fuzzy blurred-vision font. She has one
of those tassled hippy skirts that comes from India by way of an
outdoor craft market.


It must be coffee-break
time. More kids file past, clutching styrofoam cups, apples, packets of
crisps. One even has a skateboard tucked under his arm.  'Kids' feels
like the right word. Some of them can't be older than seventeen. They
are laughing, chatting each other up. Looks like this is a pretty
relaxed place to work, a fun place.


I sit on a leatherette
reception chair, and as the employees trail past I stare, mesmerised,
at the box on the wall. I can't take my eyes off it. In itself the box
is not particularly impressive, just one of those scrolling LED
displays you see in shop windows, the kind that advertises cheap
flights or deals on contact lenses. But it is the only hint in this
identikit lobby of what this organisation is doing. A stream of green
letters flows from right to left, nonsense letters with no spaces or
punctuation. 


GTTATACGTTAAGATGGATGAATGATCC=
TCGAATTAGATCCA...



Every so often the flow
halts, to be replaced by an announcement.



138300449 bases
sequenced


In the ten minutes I
wait in the lobby this number rises rapidly. 138300937... 138301181...
138301913. The receptionist sees me watching and smiles. Amazing, isn't
it, she says. I agree. I am watching, in real time, the latest results
of the Human Genome Project. The little LED shop sign is reading out
the book of life.


You know all about
this. You saw it on TV. The evil scientist throws a switch and
gradually the neatly laid-out Nazi uniform is filled with a body. The
eyes flicker to life over the toothbrush moustache and - ta da! - Adolf
Hitler, cloned from a fingernail clipping, comes goose-stepping back
into the nineteen-seventies. Flick the remote and there are some more
scientists screwing around with microscopes and babies. Flick. Doctor
Moreau making hideous human-animal crosses. Flick. Cold War mutant
superheroes (radiation accident, dummy) trading shapeshifting moves
while battling the drug
lords.


Even the news
programmes use spooky music and uplighting when they run a genetics
story. These are the items in which the presenter, always so gung-ho
when taking apart a politician, listens to the talking head with
unusual humility. Somewhere near the beginning Paxman-or-whoever will
say something elaborate which means "we're scared" and the scientific
expert will give an elaborate reply which translates as "don't worry,
we know what we're doing." Then, as soon as the explanation starts
getting technical, the producer sends kill messages through the
earpiece, and the conversation is cut short. Science lessons make bad
TV. On to developments in the Middle
East.


Yeah, you know all
about this.


The Human Genome
project is the largest scientific data-gathering exercise ever
conducted. It is also probably the most sophisticated, only rivalled by
some esoteric things being done with billion-dollar particle
accelerators and radio telescope arrays. It involves major teams in at
least eighteen countries and associates in many more, all of whom
upload their results to networked databases that are eagerly searched
by thousands of researchers every day. The sense of global excitement
is palpable and constant. The data I watch on the reception sign is a
live stream from the main server, and it speeds past day and night. Any
second the sequencing machines might hit an interesting gene, one that
fits a profile, one that gives someone in a lab somewhere an idea. One
that might make that someone, or their boss, a million
dollars.


The building in whose
lobby I am waiting is a low-profile glass and steel construction,
screened from the main road by a line of trees. The Sanger Centre,
named for a pioneer of gene sequencing techniques, is set in 55 acres
of park land attached to an eighteenth-century country house a few
miles outside Cambridge. The whole complex is owned by the Wellcome
Trust, the world's largest charity, and they have just bumped up their
funding to =A3205 million. This is a fraction of the money being spent on
the Human Genome Project internationally, $3 billion so far from the US
federal government alone. The Trust probably didn't want to sink in
more cash - the centre is already cripplingly expensive, even for an
organisation capitalised by shares in a vast multinational drug
company.  But its hand was forced.



"The Trust is concerned
that commercial entities might file opportunistic patents on DNA
sequence. The Trust is conducting an urgent review of the credibility
and scope of patents based solely on DNA sequence. It is prepared to
challenge such patents."


[Welcome Trust press
release 13th May 1998]


For 'commercial
entities', read 'Celera Genomics'. Last May a private American company
by that name announced that it possessed new technologies which would
allow it to sequence the human genome by 2001, years earlier than the
projected 2003 finish date for the international effort. By September
it was offering stock for sale, its CEO commenting on his excitement at
"entering the information side of the life science business" and
reminding his backers that "this plan reaffirms [Celera's] commitment
to creating maximum value for our shareholders." Celera promises it
will share its information, eventually. But not before paying customers
(which in practise means big drug companies) have checked out its
database, and applied for patents on anything that looks
useful.


To most people, the
idea of patenting a gene is rather like patenting the speed of light,
or the colour blue. It is information, a fact, just something that
exists out there in the world to be discovered. But in the bright shiny
future of corporate science the boundary between 'fact' and
'intellectual property' looks blurred. A decision has yet to be made on
whether gene patenting is legal, but few scientists want to take the
chance. So since last May the Human Genome Project, which is committed
to public access to its data, has been in a
race.


And the end of all our
exploring

Will be to arrive where
we started

And know the place for
the first time


[TS Eliot 'Little
Gidding']


The object of all the
fuss was first seen by a Swiss biochemist called Friedrich Miescher in
1869. Every morning Miescher would call at his local clinic to pick up
a bag of used bandages, choosing for preference the ones soaked in pus.
This being the days before chemical antiseptics, supply was plentiful.
Miescher was studying human cellular structure and in 1869 microscopes
had quite low magnification. Pus contains a lot of white blood cells,
and white blood cells have large nuclei, so unfortunately used bandages
were where it was at,
visibility-wise.


One day Miescher added
an alkali to a sample, and noticed that the nuclei burst open to
release an unknown substance, about which he could only discover that
it was acidic and contained phosphorus. So he called it (with a certain
logic) 'nuclein' and passed the baton. Ten years and a bigger
microscope later someone else spotted that 'nuclein' was made up of
little thread-like structures. These were christened chromosomes, which
in scientist-Greek means 'coloured things', because they easily
absorbed the dyes biologists used to stain samples. By the end of the
nineteenth century it was becoming clear that the coloured things had
something to do with inheritance, and since inheritance was a hot topic
on account of one Charles Darwin, chromosomes became the object of
obsessive global scrutiny.



It took fifty more
years before someone could work out what they were all watching. In
1953 Francis Crick (maths, physics) and James Watson (molecular
biology) skidded out of a prefab hut behind the Cavendish laboratory in
Cambridge and into the pages of *Nature* with a
structural model for the stuff that was now called DNA. They were just
ahead of two rival groups, and their paper showed an extraordinarily
long and thin molecule with twin coiled backbones of phosphates and
sugars, like a ladder twisted round on itself. The rungs of the ladder
were seen to be made from pairs of 'bases', substances that react with
acids to neutralise them. DNA contains only four kinds of these bases -
adenine (A), guanine (G), cytosine (C) and thymine (T). These are the
letters scrolling past on the lobby LED screen, and the aim of the
Human Genome Project is to read them all in the right order. All three
billion pairs.  


Another fifty years
further on, we know something about what that string of letters means.
DNA is data storage. Each triplet of bases, each string of three
letters in the sequence, is an instruction. DNA instructions are read
off by a molecule called RNA, which acts on them to build or link
together one of twenty amino acids. Amino acids are the basis of
proteins, and proteins are more or less what the human body is made of.
An incredible variety of these complex molecules can be formed from
folding together the twenty amino acid building blocks, and they do
every kind of biological job from creating muscle tissue to regulating
production of the white blood cells Herr Professor Miescher found in
his bandages. Knowledge of proteins means control over the human body,
and in 1999 control over the human body means happy stockholders. The
Human Genome Project is, among other things, the twenty-first century
version of an oil well. 


I walk along the
corridors of the Sanger Centre, past cabinets of gleaming glassware and
rows of hooks hung with starched white labcoats. People stroll by. A
woman wearing plastic goggles trundles a hostess trolley of used test
tubes. A bearded guy half-jogs his way to an appointment, his security
pass whipping back and forth against his chest. Around four hundred
people work here, but few of them are the high-powered research
scientists you would expect. Some of the employees are sixteen year old
school leavers, and many more are on day release from undergraduate
university courses. Team leaders tend to be young graduates, and only
those at the very top are veteran research biologists.



The hierarchy is
telling. The Human Genome Project occupies a weird twilight zone
between research and mass production. As I pass row on row of identical
labs, each with the same layout, each performing the same repetitive
tasks, the eureka clich=E9s of heroic science fall away to be replaced by
other images - car workers making model T Fords, nineteenth-century
mill hands. This is knowledge gathering on an industrial scale. Only
the upper levels of the organisation are engaged in what would
popularly be recognised as scientific research. The lower levels are
technicians, bio-hands servicing the sequencing machines.



Most of the Wellcome
Trust's funding goes on raw materials. Sequencing uses huge quantities
of chemicals, and the Sanger Centre frequently puts in orders that
exhaust the world supply of a particular biological agent. After
materials, labour is the main cost, although month by month sequencing
automation becomes more efficient. The Sanger Centre has an in-house
robotics team, dedicated to shaving time off the process with new
computer controlled machines. There is a quiet determination about the
people moving around in the building. Every increase in productivity
will give them a better chance of beating their rivals to the prize.
Behind the casual exterior, there is an obsession with
speed.


Darren is a sequencing
star. In his mid-twenties, he has spiky toothbrush hair, a shy smile
and a higher degree in one of the biological sciences. He looks like
one of the lads who were always propping up the college bar, the ones I
would meet in the very early morning when I was stumbling home from a
bender and they were dragging their hangovers off to an 8am lab
practical. Now I've given up wearing flourescents and Darren is in
charge of a sequencing team at the Sanger Centre. He is, I am told, a
man to watch. I like working here, he tells me, smiling and looking
longingly at his computer. You go home and it's over. At the end of the
day you can see what you've achieved. You feel pleased with yourself. I
ask if he thinks of his work as codebreaking. No, he says. It's more
like crossword puzzles. Then, as I process that information, he dives
through his office door and is
gone.


Darren, like most of
the staff at the Sanger Centre, is working on sequencing the Human
Genome. There are also teams working on pathogens, another area in
which there is competition from private companies. Around the Sanger
Centre are -70=B0 freezers filled with bacterial cultures of malaria,
tuberculosis, leprosy.... I peep into one of the TB labs, which looks
just like all the other sequencing production lines. Perhaps it is the
notice reminding staff not to touch the doorhandle with work gloves on,
but I find myself trying not to breathe in until I leave the room.



Whether it's TB,
malaria, the C. Elegans nematode worm or human beings whose DNA is
being sequenced, the process is the same. Tiny samples of DNA are
induced to replicate themselves through the so-called Polymerase Chain
Reaction, which causes the molecule to unravel and duplicate itself
from a bath of raw materials. Each lab has a bank of PCR ovens, cycling
samples through a precise sequence of temperatures, building
microscopic fragments into gobbets of white gloop, visible chunks of
pure DNA. The samples are then fixed into sheets of gel, a row of DNA
dabs at one end, like contestants at the starting line of a race. And
this is pretty much what they
are.


When the gels are ready
they are taken down to the main sequencing lab, a large white room
containing regimental rows of identical computers. The loud hum of hard
drive cooling fans forces you raise your voice to talk. The light is so
bright and white that for a moment you think you might have wandered
into some kind of Intel-sponsored afterworld. Here the gels are placed
into racks, each one connected to a power source and a computer. A low
voltage current is fed through them, and the DNA starts to split up and
move. Effectively the gels are a filter. Bigger molecules travel
further through it, and since each of the four bases is a different
size, each one will end up in one of four positions. These positions
can be read off by the computer, which brings the results up on screen
as a coloured dot. The big white room is filled with monitors showing a
patchwork of tiny red, green, blue and yellow smudges.



This process is 95%
accurate. The raw sequence data is then 'hand-finished' by human beings
like Darren, who look for ambiguities and resequence doubtful areas to
double-check. The Sanger Centre is proud of its quality standard. They
reckon on making only one mistake in 10,000 base pairs. The finishers
spend long caffeinated hours in front of their screens, trying to make
things fit. All this technology can only deal with relatively small
bits of the molecule at a time. The sequencers have to use enzymes to
chop it up into manageable segments. Most of the work lies in fitting
the sequenced bits back together in the right order, finding the order
of the letters in the newly-read
code.


The job is enormously
complex. Not all DNA codes for proteins. There are spaces, stop and
start signals, stretches which instruct protein production to be
switched on and off in particular circumstances. This being life, the
result of millions of years of suck-it-and-see evolutionary strategies,
DNA is also far from efficient. Protein-building instructions are
duplicated, sometimes hundreds of times on a chromosome, and there are
huge stretches of DNA which seem to do nothing useful at all,
evolutionary remnants, nonsense repetitions and garbled messages. Junk
DNA. 


Even when the job of
sequencing is done, whether by Celera or the international project, it
will only be a beginning. At the moment around 7000 of the possible
100,000 genes have been identified, along with fragments of perhaps
another 10,000 more. The map of the Human Genome is still mostly blank
areas and signs saying "here be dragons".  Geneticists have a lot of
tantalising hints, clues, strange phenomena. On chromosome four there
is a gene which has led to babies being born with extra fingers and
toes in inbred Amish communities. On chromosome seven there is a
mutation which makes modified lab mice grow enormously fat. On
chromosome eight another mutation causes accelerated premature ageing.
This is the sort of thing geneticists know in 1999. It is going to take
years, but the results of sequencing the human genome will turn this
fragmentary information into something systematic, into knowledge which
will allow prediction and, eventually, control.


"When a low race is
preserved under conditions of life that exact a high level of
efficiency, it must be subjected to rigorous selection. The few best
specimens of that race can alone be allowed to become parents, and not
many of their descendants can be allowed to live. On the other hand, if
a higher race be substituted for the low one, all this terrible misery
disappears. The most merciful form of what I call 'eugenics', would
consist in watching for the indications of superior strains or races
and in so favouring them that their progeny shall outnumber and
gradually replace that of the old
one."


[Francis Galton _Inquiries into Human Faculty_ 1883]



The word 'gene' just
means a stretch of DNA which codes for a particular protein. No more,
no less. Keep that in mind the next time you hear someone talking about
how homosexuality is 'genetic', or women are 'genetically' less
intelligent than men. Single genes do not specify complicated human
qualities like who you fancy or how good you are at playing the violin.
They make molecules. 


The dream of eugenics,
=46rancis Galton's science of selective breeding for human betterment,
came to a terrible end in Auschwitz, or at least with the Unesco
(United Nations Educational Scientific and Cultural Organisation)
"Statement on Race" in 1950. This declared that World War 2 had been
made possible by "the doctrine of the inequality of men and races", and
enshrined global scientific opposition to it. At least that's the
official story.


In practice, eugenics
has not so much died as retreated into a dark corner. Eugenic ideas
still circulate widely in Eastern Europe, their targets usually
socially-disadvantaged Romany communities. In America the publication
of 'The Bell Curve', a book which claimed that white Americans have
higher average IQs than black ones (and implied a set of right-wing
social policies based on this finding), became a major media event. The
advent of the Human Genome Project has led more than one newspaper
commentator to look forward to a future where prenatal screening for
'genetic defects', and perhaps active manipulation of foetal genomes,
can be performed for the good of society. Knowledge of genetics has
immense potential for
misuse.


Eugenics 2000 will not
be conducted through a coercive Nazi-style programme. It will probably
not be associated with any kind of government-run project of social
engineering. Like everything else in our hypermarket culture, it will
come about through the magic of consumer choice. We 'freely' undergo
cosmetic surgery procedures to conform to a current norm of beauty. Why
should we not be free to screen our unborn children, simply to ensure
they are what we want them to be? When a competitive market for
prenatal screening procedures comes about - as it certainly will - the
commercial pressure will always be in the direction of more testing,
not less. A market for products and procedures which allow rich parents
to design babies, or at least to believe that they are doing so, looks
likely to boom. Will such consumer decisions be taken from a position
of full knowledge, dispassionately applied? Or will mummy want a
perfect little Mozart, and no chances taken? The market looks likely to
dictate free will, despite the best efforts of scrupulous geneticists
to point out the flaws in the ad copy.  Doctor Michael Morgan, CEO of
the Wellcome Trust's Genome Campus, shrugs. "At every stage of medical
advance, there has always been quackery. What can we
do?"


Without the spectacle
of uniforms, flags and white supremacist rhetoric, the idea of being
free to choose to terminate a foetus carrying, say, the Cystic Fibrosis
gene (as do 1 in 25 Northern Europeans) seems only a good thing.
Genetic screening for disease will prevent much human misery. Gene
therapies promise improved lives for sufferers of many common diseases.
However, who lives and who dies has always been the fundamental
political question facing any society. Who is born must now be added to
that equation. Prenatal screening, a patriarchal culture and the
government one-child policy have led to mass terminations of female
foetuses in China. For every 100 girls born, there are now 118 boys.
The Chinese government has jumped at the opportunity to institute
mandatory genetic testing, and is reportedly pressing ahead despite a
howl of protest from the international scientific community. What kind
of effect will advances in genetics have in that
society?


As soon as
opportunities are given or denied to someone because they carry a
particular gene, a eugenic society will be in place. Insurance
companies are already clamouring for the right to screen clients.
Perhaps in ten years time you find yourself paying a higher health
premium than your neighbour. At your insurance screening they
discovered an AD4 mutation and hence you are considered at greater risk
of contracting Alzheimer's disease. Perhaps ten years later still this
finding prevents you from working as, say, an air traffic controller.
Then another ten years further down the line it becomes mandatory to
declare your screening results on an employment form, just like a
criminal record today. Perhaps your prospective boss at the widget
company reckons that this Alzheimers thing means your brain must be
like Swiss cheese and you won't be able to answer the phone properly.
So he doesn't hire you. Perhaps. Perhaps. Perhaps...=20



It's a slippery issue.
The boundary lines between disease prevention and paranoia are fuzzy,
and it is not in the interest of the emerging gene-market to clarify
such issues. Michael Morgan advocates legislation to allow individuals
to keep genetic information private, and points the finger at the
motivations of employers and insurance companies. "It is when genetic
testing becomes an instrument of public policy that we really have to
worry," he tells me. As we sit in his fifth floor office at the
Wellcome HQ in London, I feel worried enough anyway. It is important to
point out that the villains of the piece are not, for the most part,
the scientists. Geneticists know the public perceives them as
power-crazed Frankensteins, hell-bent on turning middle-England into a
B-movie horror set. A few are undoubtedly complacent about the effects
of their research. Most are just frustrated at the level of popular
ignorance. It is when science gets mixed up with the market that things
get really sticky.


GenBase is a trademark of The Perkin-Elmer Corporation.

GeneAmp is a registered trademark of Roche Molecular Systems,
Inc., licensed to The Perkin-Elmer Corporation.

GeneAmplimer is a registered trademark of Roche Molecular Systems, Inc.

GeneAssist is a registered trademark of The Perkin-Elmer Corporation.

GenePure is a trademark of The Perkin-Elmer Corporation.

GeneScan is a registered trademark of The Perkin-Elmer Corporation.

GenoPedigree is a trademark of The Perkin-Elmer Corporation.

GenoTyper is a registered trademark of The Perkin-Elmer Corporation....



Perkin Elmer is the
parent company of Celera Genomics. In February 1999 Celera got its
first customer, the US biotech giant Amgen. Founded in 1980, Amgen has
just three products, including a red blood cell regulator which in 1997
netted it a cool 1.2 billion dollars. If Celera manages to sequence the
human genome, Amgen will get first look at the data. In their press
information the two companies look forward to a "whole new world of
individualised medicine." This is how advances in genetics translate
into marketing speak. You've got couture clothes, a custom-designed
home interior, personalised number plates on your car. Of course you
want drugs tailored for your individual personality and requirements.
Rich people shouldn't have to suffer off the peg
healthcare.


If the biotech
companies have their way, they will be allowed to patent bits of the
human genome, allowing them to exploit their own little tracts of DNA
much in the way that 49'ers staked claims during the Californian
goldrush. A company called Incyte has already had a US patent accepted
for an Expressed Sequence Tag, a kind of marker showing a gene of
potential interest. Encouraged by this Incyte has patent applications
outstanding for another 1.2 *million* EST's. Meanwhile
in Europe a precedent has been set by the acceptance of patents on
three simple organisms with industrial and medical applications. Since
these living things can be patented, how the principle might extend to
human-derived material is unclear. In Iceland a company called DeCode
has made a deal with the government for the right to take samples from
its citizens. Iceland has a relatively isolated (and hence genetically
interesting) population. It also has a long history of keeping
excellent health records. Cross-referencing the two will yield much
marketable information. DeCode has just sold database access rights to
multinational pharmaceutical company Hoffman-LaRoche. Many Icelanders
feel this is happening without their
consent.


The gene market is
moving fast, too fast to be monitored by a public still watching late
night TV movies about cloning Hitler. If patents are accepted on areas
of the human genome, the vaunted idea of science as the disinterested
collective pursuit of knowledge looks likely to collapse. Sharing data
will be a thing of the past, and what is perhaps the final religious
belief of the cynical Western World (the belief in knowledge as an
absolute good) will be washed away. Patent law works on a single basic
principle - you can patent something that is an invention, but not a
thing that is merely a discovery. In the brave biotech future, the very
act of understanding DNA may well come to be seen as one of invention.
Looking and making collapsing into one. What happens to science then?=20



The young technicians
working at the Sanger Centre seem largely untouched by such big
questions. The parkland they work in is beautiful. Their prospects, as
junior employees in a booming industry, look bright. As I walk round
the building, photographing the brushed steel and plate glass exterior,
I find a barbecue. It has obviously seen a lot of action. It is such a
domestic object, such evidence of carefree times, that I have to laugh.
Over by the lake there is a football match going on. One lab is taking
on another. I stand by a little pile of ash and
watch.


Hari Kunzru



tel
tel
tel
tel